The Transcriptome
A few months ago I sequenced my genes. It is a 700 Megabyte text file that looks something like this:
AGCCCCTCAGGAGTCCGGCCACATGGAAACTCCTCATTCCGGAGGTCAGTCAGATTTACCCTTGAGTTCAAACTTCAGGGTCCAGAGGCTGATAATCTACTTACCCAAACATAGGGCTCACCTTGGCGTCGCGTCCGGCGGCAAACTAAGAACACGTCGTCTAAATGACTTCTTAAAGTAGAATAGCGTGTTCTCTCCTTCCAGCCTCCGAAAAACTCGGACCAAAGATCAGGCTTGTCCGTTCTTCGCTAGTGATGAGACTGCGCCTCTGTTCGTACAACCAATTTAGG
Each individual A, C, G and T are organic molecules that form the building blocks of what makes me "me": my DNA. It is approximately 3.3 billion pairs of nucleotides organized in around 24 thousand genes.
The information of every living being is codified in this manner. Our shape, our capacities, abilities, needs and even predisposition to disease are determined largely by our genes.
But this information is only a small percentage (less than 2%) of what can be found in the DNA that each of the cells of my body carry. That is the percentage of the DNA that encodes proteins, the molecules that carry out all the functions that are necessary for life. The other 98% is known as non-coding DNA and as of 2016 we believe only an extra 10% to 15% have a biological function that show complex patterns of expression and regulation while the rest is still largely referred to as "junk DNA". This does not necessarily mean that the majority of our DNA is junk, it only means that we still do not know why it is there nor what it does. The human genome still has many tricks up its sleeves.
The story of how our DNA is expressed and regulated is the story of the transcriptome, and despite all our technological advances, its study is still in its early stages but already showing enormous potential to better diagnose, treat and cure disease.
In order for our DNA to be expressed and produce a specific protein, the code must be "copied" (transcribed) into RNA. These gene readouts are called transcripts, and the transcriptome is the collection of all the RNA molecules, or transcripts, present in a cell.
In contrast with the genome, which is characterized by its stability, the transcriptome is constantly changing and can reflect in real time, at the molecular level, the physiology of a person depending on many factors, including stage of development and environmental conditions.
The transcriptome can tell us when and where each gene is turned on or off in the cells of tissues and organs of an individual. It functions like a dimmer switch, setting whether a gene is 10% active, or 70% active, and therefore enabling a much more intricate fine-tuning of gene expression. By comparing the transcriptome of different types of cells we can understand what makes a specific cell from a specific organ unique, how does that cell look when working normally and healthy and how its gene activity may reflect or contribute to certain diseases.
The transcriptome may hold the key to the breakthrough we have been waiting for over the last 30 years in gene therapy. There are today two complementary yet different approaches: the replacement or editing of genes within the genome (such as the widely known CRISPR-Cas9 technique) and the inhibition or enhancement of gene expression.
On the latter approach, RNA based cancer vaccines that activate an individual’s innate immune system are already in clinical trials with promising results in diseases such as lung or prostate cancer. The vaccination with RNA molecules is a promising and safe approach to let the patient’s body produce its own vaccines. By introducing a specific synthetic RNA, the protein synthesis can be controlled without intervening in the human genome and by letting the cell's own protein building machinery work without altering the physiological state of the cell.
This concept will unlock a path to a prosperous future in terms of aging prevention, brain functioning and stem cell health, as well as the eradication of cancer, hepatitis B, HIV or even high cholesterol. The transcriptome has opened our eyes to the mind-staggering complexity of the cell and when fully fathomed, it will finally enable us to truly start conquering our genetic destiny.
